Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST75515
Clone ID OST75515
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST75515
Sequence
CACTGAGGAATGTGAGAGGGTGACCACCCTACAACCCAGGGAAATGGGTTCTTGTTCTANCCTGGTGTTGGAGAATCACT
CTCTGCATCTGATGTTTACAAAGAAGATAAATTCCTCTTCAGGCCTGACACCANCCATCCACCTCCAGCAGCAAGGGAAC
CAGGAAATCTCATGGCCAGCCTGGCCAGCAAGCGAGTGGAATATGCAAAGGAGATGACTCACAGCAGACCAGCACGGTCG
GCCATGAAGCAGAGGCCAAATTGCCATCTGTTTCATCAAGTTCGTTGGTGGTTGCCGTATTTATGTCTGTGATTTATGTC
TAGGTGTCACCATGAGCCTTGGCAGCC
Sequence Type mRNA
Unitrap ID UNI14008

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71568405..71568988 259
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000064263 (Gm1631) NP_958754 gene model 1631, (NCBI) Gene [Source:MGI (curated);Acc:Gm1631-001]

 
Come back to gene ENSMUSG00000064263


For any suggestions or comments, please send an email to unitrap@crg.es