Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRO030
Clone ID RRO030
Vector pGT2Lxf
Project baygenomics

Sequence tag RRO030
Sequence
AAGAATACATGTTTACCTTTAGTGAACAAGAGCATGTTCCCAAACTCAATTTTGGGTCGTCCACCCTTCACTCCAACCCA
CCAACAGCATAATAACTTCTTTGCTCTCTCACCAACTCTTTATTCACACCAGCAACTTATAGATGCACAATTCAACTTTC
AAAATGTAGACTTGTCTAGAGCTGTGTCCTTACAGCCTCTGACATATGGAACTGTCAGTCCAATACAGACCTCAACATCT
CCATTATTTCGAGGAAGGAAGAGAATAAGCGATGAAAAAGCTTTTCCTCTTGATGGTAAACGGCAGCGTTTCCATTCACC
CCACCAAGAGCCAACTATAATCAACCAGCTAGTGCCTTTATCAGGTGACAGAAGATATTCCATGCCACCGTTGTTTCACA
CGCACTATATACCAGATATAGTCAGATGTGTTCCACCTCTTCGAGAAATTCCACTGTTAGAACCTCGAGAAATCACACTG
CCTGAGGCCAAAGATA
Sequence Type mRNA
Unitrap ID UNI8487

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 93954036..93956427 236
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042167 (Papd4) NM_133905 PAP associated domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:2140950]

 
Come back to gene ENSMUSG00000042167


For any suggestions or comments, please send an email to unitrap@crg.es