Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRO033
Clone ID RRO033
Vector pGT2Lxf
Project baygenomics

Sequence tag RRO033
Sequence
TGACTTTGGGTTGGCCTTAAAGTTCGAGGCTGGCAAGTTTGCAGGTGACACCCATGGGCAGGTTGGTACCCGGAGGTATA
TGGCTCCAGAGGTGTTGGAGGGTGCTATAAACTTCCAAAGGGACGCATTTCTGAGGATAGATATGTACGCCATGGGATTA
GTCCTATGGGAATTGGCTTCTCGTTGCACTGCTGCAGATGGACCCGTAGATGAGTACATGTTACCATTTGAGGAAGAAAT
TGGCCAGCATCCATCTCTTGAAGATATGCAGGAAGTTGTTGTGCATAAAAAAAAGAGGCCTGTTTTAAGAGATTATTGGC
AGAAACATGCA
Sequence Type mRNA
Unitrap ID UNI8488

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 48750240..48754128 142
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052155 (Acvr2a) NM_007396 activin receptor IIA Gene [Source:MGI (curated);Acc:Acvr2a-001]

 
Come back to gene ENSMUSG00000052155


For any suggestions or comments, please send an email to unitrap@crg.es