Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST74971
Clone ID OST74971
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST74971
Sequence
CACTGAGGTATGATGCTGGAAGGGACGGCTTTATCGACCTGATGGAGCTGAAACTCATGATGGAGAAACTGGGGGCCCCT
CAGACCCACCTGGGCCTGAAGAGCATGATCAAGGAGGTGGATGAGGACTTCGACGGGAAGCTCAGCTTCCGGGAGG
Sequence Type mRNA
Unitrap ID UNI27021

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 89186041..89186191 149
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026255 (Efhd1) NM_028889 EF hand domain containing 1 Gene [Source:MGI (curated);Acc:Efhd1-001]

 
Come back to gene ENSMUSG00000026255


For any suggestions or comments, please send an email to unitrap@crg.es