Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRO223
Clone ID RRO223
Vector pGT2Lxf
Project baygenomics

Sequence tag RRO223
Sequence
AGTGATGGTTGCAAGATGGCGGCGCTGAAGGAGGCTAGGAGTTACGGGTTGTCGTGTGGGCGCGTGAGCGACGGCAGCAG
GGTGTCGGTGTTCCACGTGAAGCTCACCGACAGTGCTTTGAAGGCTTTTGAGAGCTACCGGGCCC
Sequence Type mRNA
Unitrap ID UNI3327

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 73063591..73063735 143
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070002 (Ell) NM_007924 elongation factor RNA polymerase II Gene [Source:MGI Symbol;Acc:MGI:109377]

 
Come back to gene ENSMUSG00000070002


For any suggestions or comments, please send an email to unitrap@crg.es