Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST74806
Clone ID OST74806
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST74806
Sequence
GAGGTATGCGGATACCCCGTTTCTCCAGCACTGNCATGCTTTCGNTCCTGATGGNACANACTGGCATCCTGGTCTTCCTG
GTCTCCCGGCAAGTGCCATCGTCCCCAGCAGGCCTTGGGGAGCGTGTGCACGTGCTGGTACTGTCCTCGTGGCGCTCGGG
CTCGTCCTTCGTGGGCCAGCTCTTCAGCCAACACCCCGATGTCTTCTACCTGATGGAGCCGGCTTGGCACGTCTGGGATA
CGTTGTCGCAGGGCAGTGCCCCCGCACTCCACATGGCCGTGCGTGACCTGATAC
Sequence Type mRNA
Unitrap ID UNI14352

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114414600..114414891 282
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031952 (Chst5) NM_019950 carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5 Gene [Source:MGI Symbol;Acc:MGI:1931825]

 
Come back to gene ENSMUSG00000031952


For any suggestions or comments, please send an email to unitrap@crg.es