Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BC0614
Clone ID BC0614
Vector pGT2lxr
Project sanger

Sequence tag BC0614
Sequence
CATGAATCATCCGGGGAAGGGGCTGCAACGAAAGCTTCAGAGCCGCCATTGACAAGTCCTACGACAAGCCCATGGTTGAT
GATGACGACGAAGGCATGGAGACCTTGGAAGAAGACACAGAGGAAAGCTCGAGGTCAGGGAGGGAGTCCGTGTCCACGTC
CAGCGATCAGCCTTCCTATTCTCTGGAGAGGCAAATGAATGGAGACCCAGAGAAAAGGGACAAGACAGAGAGGAAAAAGG
ACAAAGCTGGAAAGGATAAGAAGAAAGACCGAGAGAAGGAGAAGGATAAACTGAAAGCCAAGAAGGGGATGCTGAAAGGC
TTGGGGGACATGTTCAGGTTTGGCAAACATCGAAAAGATGACAAGATGGAAAAAATGGGTCGAATAAAAATCCAGGATTC
TTTCACCTCAGAAGAGGACAGGGTGCGGATGAAGGAAGAACAGGAGAG
Sequence Type mRNA
Unitrap ID UNI896

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 129939593..129984284 232
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025812 (Pard3) NM_033620 par-3 (partitioning defective 3) homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2135608]

 
Come back to gene ENSMUSG00000025812


For any suggestions or comments, please send an email to unitrap@crg.es