Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRK468
Clone ID RRK468
Vector pGT2Lxf
Project baygenomics

Sequence tag RRK468
Sequence
AAGCAAGTTTCTGAGGACGCCGGTGGCGCCGTGGTTAGAAGAGGGGGTTCCAGGTCCCCACGTCGGGAGGTGCGAACCCG
AAGGTCGAGCCAGAAATGGGACGCCGGTCTTCAGACACTGAAGAGGAAAGCAGAAGCAAGAGGAAAAAGAAACACCGGAG
GCGCTCGTCTTCAAGCAGCTCTTCAGACAGCAGGACATACAGCCGCAAGAAGGGCGGGAGGAGGCCGAGGTCCGACTCAA
GGTCCTGGTCTAGAGACCGCCAGCTTCGCTCGCATTCTTATGAGAGAAGACGCAGGCGCAGATCAAGCAGCAGCTCTTCT
TATGGCTCCAGAAGGAAAAGAAGTCGCAGTCGTTCCAGGGGCCGAGGGAAACCCTATAGAGTTCAAAGGTCTCGGTCAAA
AAGCAGAACCAGAAGGTCCAGGTCAAGGCCTCGTCCACGCTCACATAGTAGAAGCAGTGAAAGATCCAGTCACAGAAGAA
CCCGTAGCAGGTCCAGGGACAGAGACAGACGTAAAGTCCGGGACAAAGAGAAAAGAGAAAAGGAGAAGGATAAAGGCAAA
GACAAAGAAGTGCACAGCATCAAACGCGGGGATTCTGGAAACATCAAAGCTGGATTAGAACATCT
Sequence Type mRNA
Unitrap ID UNI7257

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 66789637..66984786 199
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034544 (Rsrc1) NM_025822 arginine/serine-rich coiled-coil 1 Gene [Source:MGI Symbol;Acc:MGI:1914130]

 
Come back to gene ENSMUSG00000034544


For any suggestions or comments, please send an email to unitrap@crg.es