Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST74060
Clone ID OST74060
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST74060
Sequence
GAGCCTGCTGTGACTGCCTACCATAACTTATTGNGGAACTNNCNCAGGNCGGACNGGATNTTCCACCANNTGTNCCANGC
CTTGGAAGTGCTGACGGATGCTGCAGCCAGGGCTGCNTNTGACAAGGTTAGGAAAGCCNNGAAGCAGGCAGCAGAGAGGA
CCCAGAGACTTGACGAGAACAGGAAGAAAGTGAAACTTGATCTGGAGGCCAGGGAGCGGCAGGCCCAGGCCCATGGGAGT
GAGGAAGAGGAGGAGAGCAGGAGCGCCACCACACTAGAGCAGGAGATTGCTCGACTTCGAGAAGAGGGTTCCCGTCAGAG
Sequence Type mRNA
Unitrap ID UNI21315

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 119009399..119011815 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034278 (Dnajc17) NM_139139 DnaJ (Hsp40) homolog, subfamily C, member 17 Gene [Source:MGI (curated);Acc:Dnajc17-001]

 
Come back to gene ENSMUSG00000034278


For any suggestions or comments, please send an email to unitrap@crg.es