Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRO237
Clone ID RRO237
Vector pGT2Lxf
Project baygenomics

Sequence tag RRO237
Sequence
TTTAGAAGGTGTCATCAGTGGGTTGCAAGAGTACCTTGGAACCATCAAAGGCCAGGCAACTCAGGCCCAGAATGAGTGCA
GGAAGCTACAGGATGAGAAAGAGACATTGCTGCAGAGACTGACAGAAGTCCAGCAGGAGAAGGAGGAACTTGAACTCATT
GCCATGGATGCAGAAAATATGAGGAAGGAGCTTGCAGAGCTAGAAAGTGCCCTCCAGGAACAGCATGAGGTGAATGCATC
CCTACAGCAAGCCCAGGGAGATCTCAGCGCCTATGAAACTGAGCTAGAGACTCAGTTAAAACTAAAAGACGCTGAAACCA
GCCAGCTCAAGCAAGAGTTGGAAAAACTCCTAAGGCGTACTCAGTTAGAGCAATCGGTGCTTCAAACAGAACTGGAGAAG
GAGAGAGAATCCCTCAGGGATGCCCTGGGCAAAGCCCAGTCCTCAGAAGAGAAACAACAGGAGAACAACGAGCTCCGTAC
ACAGCTGAAGCAGCTG
Sequence Type mRNA
Unitrap ID UNI8510

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 34991022..34996138 188
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057110 (Cep110) NP_036148 centrosomal protein 110 Gene [Source:MGI (curated);Acc:Cep110-012]

 
Come back to gene ENSMUSG00000057110


For any suggestions or comments, please send an email to unitrap@crg.es