Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRO044
Clone ID RRO044
Vector pGT2Lxf
Project baygenomics

Sequence tag RRO044
Sequence
GCATCGCTCGGGCCTTTCCACGCCGTGGTCCCCGCCGTGGTGGCCGTTAAACGGTCTCAGAGCGGAGCTATCGGTTGTCT
GCGGCCGTAGTGAGCTTTGCTTCGTTTCCTGAAGATGGAGGGTCCTTTGTCCGTGTTCGGGGTCCGCAGCACTGGGGAGG
CGGTCCGCTCCCAGAATGTTATGGCTGCAGCTTCTATTGCCAACATTGTTAAAAGTTTCTTTGGGCCAGTTGGCTTGGAT
AAAATGTTGGTGGATGATATTGGTGATGTAACCATTACTAACGATGGTGCCACCATCCTGAAGTTACTGGAGGTAGAACA
TCCCGCAGCCAAAGTTCTGTGTGAGCTGGCTGACCTGCAAGACAAAGAAGTTGGAGATGGAACTACCTCAGT
Sequence Type mRNA
Unitrap ID UNI7823

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 13109318..13111036 178
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068039 (Tcp1) NM_013686 t-complex protein 1 Gene [Source:MGI Symbol;Acc:MGI:98535]

 
Come back to gene ENSMUSG00000068039


For any suggestions or comments, please send an email to unitrap@crg.es