Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRO051
Clone ID RRO051
Vector pGT2Lxf
Project baygenomics

Sequence tag RRO051
Sequence
TGTGGATGCCGGATGCCTCCTTGCCACATCCGTCATCACTCTGTTCAGTGATCCTAACACTGAGGAAGGTGGAAAGACTC
CATTGACGGTGGCCCAGAAAAAAGCCCAGAACATAATGCAGTCCTTTGAAAACCCATTTCGGATGTTCCTGCCTTCTCTG
GAACACAAGGCCCACATCTCTCAAGCAGCAAAGTTTGATCCTTCTTCGAAAATCTATGAAATCAGCAACCGCTGGAAGCT
GGCCAGCCAGGTCCAGGTCCAGAAAGAACCTAAAGAAGCAACCAAGAAGAAGGTAGCTGAGCAAACAGCTGCCCGGGAGG
AGGCGAAGGAGGAGGCTGCAGCCGGTGTGCTGGAACAGGCTATCCCTGTGCGGCAGCAGGCCGC
Sequence Type mRNA
Unitrap ID UNI8517

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 147947445..147953565 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017264 (Exosc10) NM_016699 exosome component 10 Gene [Source:MGI (curated);Acc:Exosc10-005]

 
Come back to gene ENSMUSG00000017264


For any suggestions or comments, please send an email to unitrap@crg.es