Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST72003
Clone ID OST72003
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST72003
Sequence
GCACTTGAACCGGACATTCCCTGACAACGTGATGTTTCGGAAGACAGCGGATCCTTGTCTCCAGAAGACCCTGTACAACG
TGCTCCTGGCATATGGGCTACACAACCCANACNTGGGGTACTTGCCAGGGAATGAATTTCATAGCTGGGTATCTGANCCT
TATCNCGAAGAATGAAGAGGGAGTCTTTTCTGGCCTTTTGNGACGCTCTTGTTGGAA
Sequence Type mRNA
Unitrap ID UNI27089

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 13186895..13189747 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038515 (Grtp1) NM_025768 GH regulated TBC protein 1 Gene [Source:MGI Symbol;Acc:MGI:1914040]

 
Come back to gene ENSMUSG00000038515


For any suggestions or comments, please send an email to unitrap@crg.es