Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST71835
Clone ID OST71835
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST71835
Sequence
CTTTTTAAACAGACTGANCACCGNGTGCTTCTCGCTCAAGATGATCTGATGTCTGAAGTGGACTCTCACTAACCATGATG
GCGACACAGACGCTAAGTATAGACAGCTATCAAGATGGACAGCAAAGCATCTGAGTTCAGTTCCCAGAATCCCTGGCAGC
TTACAACTGCCCGTAACTCCAGCTCATATATATGTAAATCAAAATAAAATAAA
Sequence Type mRNA
Unitrap ID UNI4724

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 31720642..31722336 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006705 (Pknox1) NM_016670 Pbx/knotted 1 homeobox Gene [Source:MGI Symbol;Acc:MGI:1201409]

 
Come back to gene ENSMUSG00000006705


For any suggestions or comments, please send an email to unitrap@crg.es