Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST71313
Clone ID OST71313
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST71313
Sequence
GAATTACAAGCTGCCTCCCANGAACATGGCTNAAAGTACCCAGCATTCATTGNCAACTTAATTAAAAAGCCANGNGGAGC
TCAACAGGAAAGTTCTTGTGGACCTGGCCATCTATGAACCAAAGACGTTTAAATCTTTGGCTGCATTGGCTAAGCGGAGG
CAGCAGGAGGGATTTGCTGCAGCTTTGGGGGATGGAAAGGAGCCTGAAGGTATCTTTTCCAGAGTGGTGCAGTACCACTG
AAGGCTGCAGTGCTATAGACTGTTATAAACAAGATAGGACCAAAAGGACTGTCATCAGTAACCA
Sequence Type mRNA
Unitrap ID UNI2287

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 155181030..155182821 227
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029066 (Mrpl20) NM_025570 mitochondrial ribosomal protein L20 Gene [Source:MGI (curated);Acc:Mrpl20-001]

 
Come back to gene ENSMUSG00000029066


For any suggestions or comments, please send an email to unitrap@crg.es