Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST71050
Clone ID OST71050
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST71050
Sequence
TCTTGGTGAGTGGGAAGACGAANGAGNTCCTCTTCTCCCCAAACGACTCTGCCTCTGACATCNCAAAGCACGTGTATGAC
AACTGGCCCATGGACTGGGANNAANAGCAGGTCAGCAGCCCAAACATTCTTCGACTCATTTATCAAGGCAAGATTTCTAC
NTGGAAACGTCACCCTAGGAGCATTAAAACTTCCTTTTGGCAAAACAACAGTGATGCATTTGGTGGCCANAGAGACCCTG
CCAGAGCCCAACTCACAAGG
Sequence Type mRNA
Unitrap ID UNI3005

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 149318021..149323562 87
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001687 (Ubl3) NM_011908 ubiquitin-like 3 Gene [Source:MGI Symbol;Acc:MGI:1344373]

 
Come back to gene ENSMUSG00000001687


For any suggestions or comments, please send an email to unitrap@crg.es