Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRO087
Clone ID RRO087
Vector pGT2Lxf
Project baygenomics

Sequence tag RRO087
Sequence
CCATGGGAATTATTTCCAAGAATAGTGCAAGATATTTTTAATTATATTTACTCCATGGATGAAAATTTGGAATTTCATAT
TAAGGTTTCATATTTTGAAATATATTTGGATAAGATAAGGGACTTGTTAGATGTTTCAAAGACTAACCTTTCAGTCCATG
AAGACAAAAACCGTGTTCCCTATGTAAAGGGGTGCACAGAACGTTTCGTGTGTAGTCCAGATGAAGTCATGGATACCATA
GATGAAGGGAAATCCAACAGACATGTCGCAGTTACAAATATGAATGAACATAGCTCTAGGAGCCACAGCATATTTCTTAT
TAATGTAAAACAAGAGAATACACAAACGGAACAGAAACTCAGTGGAAAGCTTTATCTGGTTGATTTAGCTGGCAGTGAGA
Sequence Type mRNA
Unitrap ID UNI7309

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 6225318..6226943 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006740 (Kif5b) NM_008448 kinesin family member 5B Gene [Source:MGI Symbol;Acc:MGI:1098268]

 
Come back to gene ENSMUSG00000006740


For any suggestions or comments, please send an email to unitrap@crg.es