Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST70486
Clone ID OST70486
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST70486
Sequence
GAACACATGCCAAAAGATACAACATAATGGCTTTTAATGCAGCCGATAAAGTCAACTTTGCTACCTGGAACCAGGCACGG
CTGGAGCGAGATCTGAGCAACAAGAAGATTTACCAGGAAGAAGAGATGCCAGAGTCCGGTGCAGGCAGTGAATTCAACCG
CAAGCTTAGGGAGGAGGCGCGCCGGAAGAAGTATGGCATTGTCCTAAAGGAGTTTCGGCCTGAGGATCAGCCTTGGCTAC
TCCGTGTCAATCAGTAGG
Sequence Type mRNA
Unitrap ID UNI24859

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57147153..57149183 178
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002658 (Gtf2f1) NM_133801 general transcription factor IIF, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:1923848]

 
Come back to gene ENSMUSG00000002658


For any suggestions or comments, please send an email to unitrap@crg.es