Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRO094
Clone ID RRO094
Vector pGT2Lxf
Project baygenomics

Sequence tag RRO094
Sequence
CTGCTTCCGGCCCCGTTGCCTGGCCCGGCCCCGCGATTCCCCCGGGACGAAGCCTGGGAAA
Sequence Type mRNA
Unitrap ID UNI8531

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 133228250..133228308 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043257 (Pigv) NM_178698 phosphatidylinositol glycan anchor biosynthesis, class V Gene [Source:MGI (curated);Acc:Pigv-002]

 
Come back to gene ENSMUSG00000043257


For any suggestions or comments, please send an email to unitrap@crg.es