Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST69707
Clone ID OST69707
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST69707
Sequence
AGCTCCTGGTGATGCCCTTCTGCAGACAGACCTACAGAAGATCATGGGGATGGAATTCAGCGAGGATAAGGTCCAGTACT
TGGTGTACCAGATGCTCAAAGGTCTAAAGGACATNCACTCCGCTGGCATCGTTCACAGGGACCNGANACCGNNCAACCTG
GNTGNGAATGAANACTGCGAGCTGAAAANCCNNGACTTTGGGCTGNCCCGGCACACANACACTGACATGACCGGCTATGT
GGTGACCCGCTGGTACCGNNCCCCCNAGGCGATCCTCANCTGGATGCATTACAACCANACAGNCGACATNTGGTCTGGNG
NGTGCNTCATGGAAGAAATGCTCNNTGTAAACACACTNTTCCAGGNCCTGGACTACCTGGNCCAGCTGACCCACATCCTT
GAAAG
Sequence Type mRNA
Unitrap ID UNI27116

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 28912197..28914456 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004864 (Mapk13) NM_011950 mitogen-activated protein kinase 13 Gene [Source:MGI (curated);Acc:Mapk13-001]

 
Come back to gene ENSMUSG00000004864


For any suggestions or comments, please send an email to unitrap@crg.es