Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRO113
Clone ID RRO113
Vector pGT2Lxf
Project baygenomics

Sequence tag RRO113
Sequence
CAAAATAGAGTATGTTGCACGAACATCAGAGAGCTCAGAAGAATTCCTTGAAGAAGAGCCTGAGCAGGGAGTGATTGACT
TTGAGGATGAAAGCGGTGATAAAGATGCACAGCCTGCTCTGGAAACTCAGCCACGCCTGCAGAAACAAGATGGAGACAAG
GACTCTGCGTTAGAGCCTGTGAATGGGGAGGTAATGGATGCTGCCCTCAAGCCCTCTCTTACAACTGAAGACGAGGACTC
CACCAGTGAGGGTCTTGAAGAAGACTTAAAGGTTCCACCTTTTAATTCCAGCGGAGAACCTGGAAATCCTGTTCCACTAG
TAGCAGAGTCTTCAAAAGTGCCCGAGGCCACATTAGCTA
Sequence Type mRNA
Unitrap ID UNI3796

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97888330..97892845 201
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041817 (B230112C05Rik) family with sequence similarity 169, member A Gene [Source:MGI Symbol;Acc:MGI:2444268]

 
Come back to gene ENSMUSG00000041817


For any suggestions or comments, please send an email to unitrap@crg.es