Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST69562
Clone ID OST69562
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST69562
Sequence
TTTTGGGGTTTTGGCTTGGGGTAGGGGGGNCTNNTTTAATACACACTGAGCCTCAATAAACNANAACTGNATATGAACAG
TTTCACTCAGGACCCTNACCGGTGNATCATGATNCCTTGNAGNCCANGCGCCCACAGCCTGGAGCCAGTTTCTGATGCCC
ATTTCCAGCGTGTTAGTGCTGCGGTTTTACCTTTAGTTCACTCGCTGCCAGAAGGCTTGAGGTCGTCTGCAGATGCTAAG
AAGGATTCAGCATTTGGAAGCAAACATGAAGCTCCATCCTNTNCTTTGGCTGGGCAACCATGTTGGAGATGACCAAAATG
CTTCACCA
Sequence Type mRNA
Unitrap ID UNI14658

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62233200..62236569 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]

 
Come back to gene ENSMUSG00000018501


For any suggestions or comments, please send an email to unitrap@crg.es