Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST69164
Clone ID OST69164
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST69164
Sequence
AGGCGTGGACTGTGAGCGGTTGCAGAGCTGTTCTCAGGACATATTCCTTTAACATTCGGGAGGAACACATCCAGGAGGTG
CGCAGTTGACTGAGGAGGCCCGGAGAATCTGAAGACTCCGATGACATCAGAGTTGCTTTTCAACAGCCTTCTCAGCTTCC
TTTCCCACATAGCAGAGGCTCAGGCTGAGGCAGACGATACTGACCNGCGTCCGNTGAGCATCNNACNACGNNNAAGAAGG
ANNACCANCGTATTCCNCTGAGACNTGGTTGCCAGCGCTTGCCGCTGT
Sequence Type mRNA
Unitrap ID UNI27121

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 76330991..76352793 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048490 (Nrip1) NM_173440 nuclear receptor interacting protein 1 Gene [Source:MGI (curated);Acc:Nrip1-001]

 
Come back to gene ENSMUSG00000048490


For any suggestions or comments, please send an email to unitrap@crg.es