Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST68988
Clone ID OST68988
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST68988
Sequence
TACAGAGTACAGATTATGGCAACTTCCTGGCCAATGAAGCGTNNCCTCTGACGGTGTCAGTCATCGATGACAAGCTCAAG
GAGAAGATGGTAGTAGAGTTCCGCCACATGAGAAACCATGCTTATGAGCCGCTCGCCAGCTTCCTGGACTTCATAACTTA
TAGCTACATGATTGACAACGTGATCCTGCTAATCACAGGCACACTGCACCAGCGTTCAATAGCTGAACTTGTGCCCAAGT
GCCATCCGCTAGGCAGCTTTGAGCAGATGGAGGCTGTGAACATCGCACAGACACCTGCAGAGCTCTACAATGCCATTCTG
GTGGACACACCCCTGGCGGCTTTTTTCCAGGACTGCATCTCAGAGCAGGACCTTGATNAGATGAACATCGAGATAATCCG
AAAT
Sequence Type mRNA
Unitrap ID UNI22766

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108053086..108063377 179
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013160 (Atp6v0d1) NM_013477 ATPase, H+ transporting, lysosomal V0 subunit D1 Gene [Source:MGI (curated);Acc:Atp6v0d1-001]

 
Come back to gene ENSMUSG00000013160


For any suggestions or comments, please send an email to unitrap@crg.es