Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST68843
Clone ID OST68843
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST68843
Sequence
ATCTCTCCGAGTGCACTCATTTCCCCCACGGATGCTGCATTAGCACCCCCTCCTCCCTCAGTTTTCTCGGAGTGGTTTGG
GGTCTGAAGGCTTCCTGTTCTATCACGTGTGTGTGTGTGCTGCGCATGCTATGAAGNTGTCTGTAGCTNAAGCCATTGAA
GGACCTATACGTACCTAGGAGCTGAGAGCTGTCCCGGCCAGCTTGAGTGTGNACATCTTGAAATAAATGAATGACTTAG
Sequence Type mRNA
Unitrap ID UNI18868

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 139045197..139045435 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066036 (Ubr4) ubiquitin protein ligase E3 component n-recognin 4 Gene [Source:MGI (curated);Acc:Ubr4-001]

 
Come back to gene ENSMUSG00000066036


For any suggestions or comments, please send an email to unitrap@crg.es