Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST68547
Clone ID OST68547
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST68547
Sequence
TTTGATGAGTGGGTGGCCCCGACCCCTGAGGTGGCTGACATGCAGAATCACCTGCACCGGAGTGTTTTCCTCACCTTCCT
CCGAATGTCCACGCACAAGGAATCCAAAGACCACTTCATTTCTNCATNTGCATTTGGANAAATCCTCTACAACAACTT
Sequence Type mRNA
Unitrap ID UNI24828

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4547129..4549792 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020412 (Ascc2) NM_029291 activating signal cointegrator 1 complex subunit 2 Gene [Source:MGI (curated);Acc:Ascc2-001]

 
Come back to gene ENSMUSG00000020412


For any suggestions or comments, please send an email to unitrap@crg.es