Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST68481
Clone ID OST68481
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST68481
Sequence
TGACATCTTATTCCTGCTTGGGGCTTCCCTGTATGCTGTGTCTAACAGTGTGTGAAGAATACATCGTGAAGAAGCTGAGC
Sequence Type mRNA
Unitrap ID UNI27149

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 53655872..53655950 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042195 (Slc35f2) NM_028060 solute carrier family 35, member F2 Gene [Source:MGI Symbol;Acc:MGI:1919272]

 
Come back to gene ENSMUSG00000042195


For any suggestions or comments, please send an email to unitrap@crg.es