Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST68427
Clone ID OST68427
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST68427
Sequence
CCCCACATGCCATGCAATTCCCTGCTGAGCTGACCAAGGGTGCCTGTGTGACCTCCCGGCCTGCTGAGCTTCGACTCATC
TGCATCTATTTCTTCACTGCACACCTCTTTCAGGATGACCGGAACTCATCACTGCTCAATAACTATGTCCTGGGGGCCCA
GCTGGATCACAGGCCTGTGAACAACCTTCAGAAGCCAGTCAACATCAGCTTCTGGCATAATCGGAGTCTGGTACTGTTGG
GTCTACCCCCACCCCAGCCCAGTCAGCCCTGGCTTGGCCAAATTGAAAACCATGGCACCATCTGGGAAACAACTTTAAAT
CTGTTTTTTTTTTTTTTGAAAAATT
Sequence Type mRNA
Unitrap ID UNI27151

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 97458368..97459181 231
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061577 (Gpr114) NM_001033468 G protein-coupled receptor 114 Gene [Source:MGI (curated);Acc:Gpr114-001]

 
Come back to gene ENSMUSG00000061577


For any suggestions or comments, please send an email to unitrap@crg.es