Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST68360
Clone ID OST68360
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST68360
Sequence
ACTGAGCTGGCAAAGTTTTTGAGTGTTTCCCTGGTGAGATTTCTTGAATCTAAGCTATGCGGCTCTCAGCCCTGCTGGCC
TTGGCATCCAAAGCCACTTCCTCCCCCTTCTACCGCTATGGAATGAGCCGTCCAGGTTCCATAGCAGACAAAAGGAAGAA
TCCTCCATGGAGCAGGCGGCGCCCAGTAGTGGTAGAGCCCATCTCTGATGAAGACTGGCACCTATTCTGTGGAGACATGG
TAGAAATCTTAGAAGGCAAGGATGCTGGGAAGCAAGGCAAAGTAGTCCAAGTCGTTCGGCAGCGAAACTGGGTTGTCCTG
GAGGGGTTGAACACGCATTACCCGATTCATTGGGCGNACCCAAGGACCACCGA
Sequence Type mRNA
Unitrap ID UNI17335

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 87725733..87726345 236
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019710 (Mrpl24) NM_026591 mitochondrial ribosomal protein L24 Gene [Source:MGI (curated);Acc:Mrpl24-002]

 
Come back to gene ENSMUSG00000019710


For any suggestions or comments, please send an email to unitrap@crg.es