Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST68341
Clone ID OST68341
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST68341
Sequence
ACTGAGGCACCTGGAAGGGTGAAGGCGAGAGGCAGATGACGACGCTGAACACAGGCTCCGCAAGAATCTCCATAATGAAT
GGATCCAGTGTGGCAAGTACATCACCCAGTGTGAAATGCAAAGAAGACCAAGGATTAAATGGACATGAGGAAAAGGAAAA
CCCATTTGCAGAATACATGTGGATGGAAAATGAAGAGGATTTCAACAGACAGGTGGAGGAAGAGCTACAGGAGCAAGACT
TCTTGGACCGCTGCTTCCAGGAGATGCTGGATGAAGAGGACCAGGACTGGTTCATCCCAGCACGAGACCTGCCTCAGGCT
GTGGGGCACTTACAACAGCAGTTAAATGGACTATT
Sequence Type mRNA
Unitrap ID UNI27153

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 83759928..83781324 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045896 (Paip2b) NM_146169 poly(A) binding protein interacting protein 2B Gene [Source:MGI Symbol;Acc:MGI:2386865]

 
Come back to gene ENSMUSG00000045896


For any suggestions or comments, please send an email to unitrap@crg.es