Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST68275
Clone ID OST68275
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST68275
Sequence
AACTGAGGATCAGTTCATGTGTGGAGAAACAGTCCCAGCACCTTCAACCAACAAGGAGTTAGTTAAATGCTGAAGAGGCT
CTCAGGTACCCACATCCTGAACCGTGGGGGCTGAGCCCAGGTGGATGGATCCAGTGCAGAGTTACCAACCTCCTCGATGG
GCAGCCTCAGGGGTGTGATCTTCATCAGCCACTGAACTCAGCATGAAAAAGGGAGCCTATGACATGCCAGCCCTGGATTC
CATACTGGGACTGGAAGGATTCCTAATTGTCCGTCTGAATTTAAGGAAGAGCCTTATTATAAACTGTGGTTTTTCCTTCA
GTCGGCTGCATCATTTGAACATCTGGAAATTCATTTT
Sequence Type mRNA
Unitrap ID UNI13971

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 32896083..32896437 353
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021905 (Dph3) NM_001047433 DPH3 homolog (KTI11, S. cerevisiae) Gene [Source:MGI (curated);Acc:Dph3-001]

 
Come back to gene ENSMUSG00000021905


For any suggestions or comments, please send an email to unitrap@crg.es