Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST68267
Clone ID OST68267
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST68267
Sequence
GACTGAGGTTCTATGGTACAGAAATTCATGAGCCGGTACCAGGCAGCCCTGNTGGGACTACNTNATTACTTCTTGNGGAA
NTCTGAANGGGNGNNCTGGATGGACCACCCGAGCANACTNTCGCGACTCTGGAGAGGCCCTAATGTCACAGTCCTGACTG
GTCTCACCAGAGGCAACTCTCGAATCTTTTACCGAGAGGTGCTGCCAATCCAGCAGGCATGCAGGGCANAAGTCGTGTTT
NTCCATGGAAAAGCATTTAATTCCCACACATGGGAACAGCTGGGGACATTGCAGCTACTGTCAGAGAGGGGCTACCGGGC
TGTGGCCATCGACCTTNCAGGGTTTGGGAACTCAANCCCTTTAANAGGAGGGGAGCACAGAAGA
Sequence Type mRNA
Unitrap ID UNI18151

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106343148..106346639 142
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042210 (Abhd14a) NM_145919 abhydrolase domain containing 14A Gene [Source:MGI Symbol;Acc:MGI:1915894]

 
Come back to gene ENSMUSG00000042210


For any suggestions or comments, please send an email to unitrap@crg.es