Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST68264
Clone ID OST68264
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST68264
Sequence
CTGAGTTTGGAACTGATCAAAGAACCTGTTTNCCAANGGGTGNNCTCATANGTCGCGACATGGATGGCNGNNGTGGCTTC
NTATCTCTACGAGAGGGCCTTNACAATGTCCTTTGNGTAAGAATGAGATAACCAAAAGGAGCCTACAGGGAAGCACAAGG
TTTAGTCAGCTTGCTGAAGAGCTGCTGAGAATAATGGCTGCTTTTGAGCTTGACACGGGAATGCAGCTTACAAATGGTTT
TAGTTTTTCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI22607

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 101393441..101401350 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017146 (Brca1) NM_009764 breast cancer 1 Gene [Source:MGI (curated);Acc:Brca1-001]

 
Come back to gene ENSMUSG00000017146


For any suggestions or comments, please send an email to unitrap@crg.es