Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST68145
Clone ID OST68145
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST68145
Sequence
ACTGAGTCTGGATGTGGATAGTGAAGCTAAGAAACTACTGGGATTAAGGACAAGAAACATCTGGNGATGGGTGACATTCC
AGCAGCTGTTAATGCATTCCAGGAAGCAGCTAGTCTTTTAGGTAANAAGTNTGGNNAAACGGCTAATGAGNGTGGANAAN
CCTTCTTTTTTTATGGNAAGTCACTTCTGGAGTTAACCAAAATGGANAATGGNCTGTTGGGAAATGCCTTAAAAGGAGTG
CTTGTTGAAGAGGAAAAATAAAAAA
Sequence Type mRNA
Unitrap ID UNI11645

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116284622..116291587 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028693 (Nasp) NM_016777 nuclear autoantigenic sperm protein (histone-binding) Gene [Source:MGI (curated);Acc:Nasp-001]

 
Come back to gene ENSMUSG00000028693


For any suggestions or comments, please send an email to unitrap@crg.es