Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST68111
Clone ID OST68111
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST68111
Sequence
ATTACAGGGATCACTNGAATGACAGTCGATTAGGANCCCACGAAGGCTTGTCCCCAACACCTTTCATGAACTCAAATCTG
ATAGGGAAAACATCAGAGNGAGGCTCATTTTCCCTGTACAGCAAAGACTCTGGACTCTCAGGCTGTCAGGCA
Sequence Type mRNA
Unitrap ID UNI4546

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 71791760..71848306 80
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032228 (Tcf12) NM_011544 transcription factor 12 Gene [Source:MGI Symbol;Acc:MGI:101877]

 
Come back to gene ENSMUSG00000032228


For any suggestions or comments, please send an email to unitrap@crg.es