Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST68086
Clone ID OST68086
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST68086
Sequence
ACTGAGAGTGCTTGGGATCCCGTGTGTTTTTGCTGAACTTGTAAAGGAGACATCTGGATGGTGGATTAACACGAACCTGT
GGGCAGCCTCATAGCTGANAACATTGGATTTTCACCCTAGTCCAGCAGCTCTGCTGCTCACATAGATACAGATGAATGAA
GACCCCATTCGGGAAGACACCTGGCCAACGGTCCANAGCTGATGCAGGCCATGCTGGAGTATCTGCAAACATGATGAANA
AGAGGACNTCTCACAAAAAACATCGGACCAGNGTGGGACCAAGCAAGCCTGTGTCCCAACCCCGGCGGAACATCGNAGGC
TGCAGGATCCANCATGGATGGAAAGAGGNCAATGGCCCTTGTTACCCAATGNAAGGGGACTGTCCTGGACCAGGTGCCTG
TGAATCCTTCCTGTATCTTATAAAGNACGATGGATTTGACTGTGTTTATGGACTANAACTTAATAAGGATGAAAAAATTT
CTGCNCTGGAAGGCCTCCTTGAAAAAGTTGCAACATTCCGGTTAAGGG
Sequence Type mRNA
Unitrap ID UNI10501

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 51218455..51234979 217
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021395 (Spin1) NM_146043 spindlin 1 Gene [Source:MGI Symbol;Acc:MGI:109242]

 
Come back to gene ENSMUSG00000021395


For any suggestions or comments, please send an email to unitrap@crg.es