Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST68006
Clone ID OST68006
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST68006
Sequence
TTGCAAGGCACGAAGTCCGAGAAATTGAACAGCGCCATACAATGGATGGCCCTCGGCAGGATGCAACTCTGGATGAAGAA
GAAGACATAATCATCATTTATAACAGAGTGCCCAAAACTGCAAGCACCTCGTTCACCAATATAGCCTACGACCTGTGTGC
AAAGAATAGATACCATGTTCTTCACATCAACACTACCAAAAATAACCCAGTANTGTCATTGCAAGATCAGGTGCGCTTTG
TGAANAACATAACCACCTGGAACGAGATGAAGCCAGGCTTNTATCACGGACACATCTCTTACTTGGATTTTGCAAAATTC
GGNGNGAAGAAAAAACCAATTTATATCAATGTCATCAGGGACCCTATTGAGAGGCTAGNTTCCTACTATTACTTCCTGA
Sequence Type mRNA
Unitrap ID UNI27165

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 144110290..144128240 230
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040151 (Hs2st1) NM_011828 heparan sulfate 2-O-sulfotransferase 1 Gene [Source:MGI Symbol;Acc:MGI:1346049]

 
Come back to gene ENSMUSG00000040151


For any suggestions or comments, please send an email to unitrap@crg.es