Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST67987
Clone ID OST67987
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST67987
Sequence
CCGCTTCATCTGAGGAGAACCATACCGACTTTTGGCCGGCGTGGAGTACGTTGTTGGGAGGAAAAACTGTGGCATTCTGA
TTGAAAATGATCAGTCAATCAGTCGAAACCATGCTGTCTTAACAGTAAACTTCCCTGTAACCAGTTTGAGTCAAACAGAT
GAAATTCCTACATTAACAATAAAAGATAATTCTAAGTATGGAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI27168

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 15889453..15890973 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028224 (Nbn) NM_013752 nibrin Gene [Source:MGI (curated);Acc:Nbn-001]

 
Come back to gene ENSMUSG00000028224


For any suggestions or comments, please send an email to unitrap@crg.es