Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST67977
Clone ID OST67977
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST67977
Sequence
TGGGCCGTTTTGTGCCCTCCCCGCCTCCAAATTGCCTCAGTTACAAATCANAGGGCAGGCTTGGTGAGCAAGACTGGCAA
GCACATTTTAAGGTCCCGTGCTGTGGGGTTGATCCATCTCAACTTGAGTCANAANAGGCAGAAGTGGATGTGNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGACTTTAANAGACTCCTGTACTGACAACTCCATGCAGT
TCGGAACCANAACAACTGCGGCTGAACCAGGGTTCATGGGGACATGGCAAAACGCTGACACTAACCTCTTATTCAAAATG
TCCCAACAGGCCATCCGNTGCACATTGGTAAACTGCACGTGTGAGTGTTTCCAGCCTGGGAAGATTAACCTGCGGACGTG
TGATCAGTGTAAACATGGCTGGGNGGCACATGCCTTGGATAAACTCAGCACACAAGCACCTTGTCCCCCCCACTTAAG
Sequence Type mRNA
Unitrap ID UNI1445

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 84036984..84201805 124
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028487 (Bnc2) NM_172870 basonuclin 2 Gene [Source:MGI (curated);Acc:Bnc2-001]

 
Come back to gene ENSMUSG00000028487


For any suggestions or comments, please send an email to unitrap@crg.es