Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST67848
Clone ID OST67848
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST67848
Sequence
GAAACATTCCATGGAGCATGTGTCCATGGCTTGTGTTCACCTGGCTTCCAAAATAGAAGAGGCTCCGAGACGAATCAGGG
ATGTCATCAATGTATTCCATCGCCTTCGGCATCTGANAGAGAAAAAGAAGCCTGTGCCTCTGGNGCTTGATCAAGAGTAT
GTTAACCTAAAGAACCAGATTATAAAGGCAGAGAGACGGGTTCTCAAGGAGTTGGGCTTTTGTGTCCATGTGAAGCACCC
TCACAAGATAATCGTTATGTACCTTCAGGTGTTAGAATGTGAGCGTAATCAACACCTGGTCCAAACTGCATGGGTAGCCT
CTGAGGGTAAAAT
Sequence Type mRNA
Unitrap ID UNI22371

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 155187336..155192665 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029068 (Ccnl2) NM_207678 cyclin L2 Gene [Source:MGI (curated);Acc:Ccnl2-001]

 
Come back to gene ENSMUSG00000029068


For any suggestions or comments, please send an email to unitrap@crg.es