Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRO470
Clone ID RRO470
Vector pGT2Lxf
Project baygenomics

Sequence tag RRO470
Sequence
GGACTGAGGCCAGTGTCCTTTACTCCTACAGCATTAAGCAATGGCATCAACCATTCCCCTCCTACCCTGAATGGTGCCCC
ATCGCCACCACAGAGATTCAGCAATGGGCCTGCCTCCTCCACATCGTCAGCACTAACGAATCAACAGCTGCCGGCTACTT
GTGGTGCTCGGCAGCTCAGCAAGTTGAAACGCTTCCTCACCACTCTGCAGCAGTTTGGCAATGATATCTCACCTGAGATC
GGCGAGAAGGTTCGGACTCTCGTTCTAGCCTTGGTGAACTCAACAGTAACAATTGAAGAATTCCATTGCAAGCTCCAGGA
GGCCACAAACTTTCCTCTTCGTCCATTTGTGATTCCATTTCTCA
Sequence Type mRNA
Unitrap ID UNI8574

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154326246..154336331 242
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038533 (Cbfa2t2) NM_172860 core-binding factor, runt domain, alpha subunit 2, translocated to, 2 (human) Gene [Source:MGI (curated);Acc:Cbfa2t2-001]

 
Come back to gene ENSMUSG00000038533


For any suggestions or comments, please send an email to unitrap@crg.es