Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST67794
Clone ID OST67794
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST67794
Sequence
GAACTGAGAGTTTGGATCCCTCCACCAGGCACTAAAGATGTTATGGCAGAACCTCCATCAGTTTGGCCAGAAGTTGGTTC
GCCGGCGGCCCCTGGCGGCAAACGAACAGTCTGAGTCTTCCTTGTCTCGATGTCTGACCACTTTGGACCTGGTGTCCTTG
GGTGTGGGCAGTACCCTGGGTGCAGGCGTGTATGTCCTGGCCGGGGAGGTGGCCAGAGAGAAAGCTGGACCGTCCATCAT
CATCTGCTTCTTAATTGCTGCCCTGTCTTCAGTGATGTCAGGACTCTGTTATGCCGGAGTTTGGGGCCAGGGTACCATGC
T
Sequence Type mRNA
Unitrap ID UNI11841

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3163984..3164297 311
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054753 (AU018091) NM_001004153 cationic amino acid transporter 5 [Source:RefSeq peptide;Acc:NP_001004153]

 
Come back to gene ENSMUSG00000054753


For any suggestions or comments, please send an email to unitrap@crg.es