Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST67749
Clone ID OST67749
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST67749
Sequence
ACTGAGTCCAGAGACTTGAAGCCAGAGAACCTGCTGTTGGATGAGAAAAACAACATCCGCATCGCAGACTTTGGTATGGC
GTCCCTGCAAGTGGGGGACAGCCTCCTGGAGACCAGCTGCGGGTCCCCCCATTACGCATGTCCAGAGGTGATCAAGGGGG
AAAAGTATGATGGCCGCCGGGCAGACATGTGGAGCTGTGGAGTCATCCTATTTGCCCTGCTTGTGGGGGCACTGCCCTTC
GATGACGACAACCTGCGCCAGCTACTGGAGAAGGTGAAACGTGGGGTCTTCCACATGCCTCACTTCATCCCTCCAGACTG
CCAGAGCCTCCTGAGAGGGATGATTGAAGTGGACCCCAAAAAAAGGCTCAGTCTGGAGCAAATTCANAAACATCCTTGGT
ATCTGGGCGGGAAACACGAACCAAACCCTTGCCTGGAGCCAGCCCCANGCCGCANAGTAACCATGCGTAGCCTGCCTTCC
AATGGCGAACTGGACCCCTGACGTTCTGGAAAGCATGGGT
Sequence Type mRNA
Unitrap ID UNI27177

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4650297..4656782 142
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035390 (Brsk1) NM_001003920 BR serine/threonine kinase 1 Gene [Source:MGI (curated);Acc:Brsk1-002]

 
Come back to gene ENSMUSG00000035390


For any suggestions or comments, please send an email to unitrap@crg.es