Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST67721
Clone ID OST67721
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST67721
Sequence
CCCCAAGAATGTGACCCACCACAAGCTAATACATGCTGCTTCAGAGAGGGTGCTGAGTGACAGCAAAACGATCTTGGAAG
AAAACATCCAGGACCAAGACGTCTTGTTATTGATAAAAAAGCGTGTTCCTTCTCCACTCCCTAAGATGGCTGACGTCTCA
GCAGAAGAAAA
Sequence Type mRNA
Unitrap ID UNI27181

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 25870413..25871913 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036352 (Ubac1) NM_133835 ubiquitin associated domain containing 1 Gene [Source:MGI (curated);Acc:Ubac1-001]

 
Come back to gene ENSMUSG00000036352


For any suggestions or comments, please send an email to unitrap@crg.es