Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST67710
Clone ID OST67710
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST67710
Sequence
CACTGAGGAGTCTAGAGCAGGAGGATCTTGAGTTNAAGNGNAAGGNTGGTATANGTAGTGTGTGGAGAACAGCTGGNGGC
AACGAGATGGCTGCTTCTGTCCCATGGGCCTGCTGTGCTGNGCTTGCCGCTGCCGCCGCCGNTGTATACACGCAGAAACA
CAGTCCACAGGAGGCACCCCACGTGCAGTATGAGCGTCTGGGCGCAGATGTGACGCTGCCGTGTGGGACAGCGAGCTGGG
ACGCAGCTGTGACATGGAGGGTAAACGGGACAGATCTGGCCCCTGACCTGCTCAACGGCTCTCAGCTGATACTGCGAANC
TTAAAACTGGGCCACAGTGGCCTATACGCCTGTTTTCACCGNGNANTTCTTNGGACTTGGGGCCNCNAANGCCTTTTTAA
ATNTGGGGTTTGCCGCCCGCGGGAGCCTGGTGCTTCAGCTTGCCGCTTCAACAACTTACCCCAAGGGCTTCTACTGCAGC
TTGGAACCTGCCCAACCCCCACCTACATNCCCAATACCTTCAAATGTG
Sequence Type mRNA
Unitrap ID UNI17203

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 41610579..41622138 189
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028444 (Cntfr) NM_016673 ciliary neurotrophic factor receptor Gene [Source:MGI (curated);Acc:Cntfr-002]

 
Come back to gene ENSMUSG00000028444


For any suggestions or comments, please send an email to unitrap@crg.es