Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST67450
Clone ID OST67450
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST67450
Sequence
GGGTCTACACAATACCCTATGTAGCAGAAAGGCCGATTTCTTACCTATTGGAGAACATCTGTCTCTAAATAAAATCTCAA
TTGTTCCAGAGGAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI27126

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5273931..5274002 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024853 (Sf3b2) NM_030109 splicing factor 3b, subunit 2 Gene [Source:MGI Symbol;Acc:MGI:2441856]

 
Come back to gene ENSMUSG00000024853


For any suggestions or comments, please send an email to unitrap@crg.es