Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST67436
Clone ID OST67436
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST67436
Sequence
TAAAGAGGACTGTTTCCAAATACTTTTTCACTTTTAGCTGTGTATTATGGATACTAAGGAAGAGAAGAAGGAACAGAAGG
AACGGAAACAGAGTTATTTTGCTAGACT
Sequence Type mRNA
Unitrap ID UNI18905

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 30491526..30491629 101
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039697 (Ncoa7) NM_172495 nuclear receptor coactivator 7 Gene [Source:MGI Symbol;Acc:MGI:2444847]

 
Come back to gene ENSMUSG00000039697


For any suggestions or comments, please send an email to unitrap@crg.es