Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST67432
Clone ID OST67432
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST67432
Sequence
CCTGAGGGAGATTCCCGGACTCTTCCTTTTCTGAGAATGTGAGTGCTGTTCANAAATTANACTTTTCAGATACAATGGNG
CAACAGAAATTGGACGACATCAAGGATCGAATAAAGAGAGAAATAAGGAAAAAAAT
Sequence Type mRNA
Unitrap ID UNI20416

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 142516550..142516680 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004591 (Pkn2) NP_848769 protein kinase N2 Gene [Source:MGI Symbol;Acc:MGI:109211]

 
Come back to gene ENSMUSG00000004591


For any suggestions or comments, please send an email to unitrap@crg.es