Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST67164
Clone ID OST67164
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST67164
Sequence
GCTGGTTCCAGACTCCAGCANGCTGCCGTTAGAAGGACCCCGCCAGCCCATGTGGTGGNGGGAGATGTTCGGCAGGCGGC
CGATGTGGACAAGACTGTGGCTGGGCAGGAAGCTGTCATCGTGCTANTGGGCACTGGCAACGACCTCAGTCCCACTACAG
TAATGTCCGAGGGCACCCGGAACATCGTGACAGCCATGAAGGCACATGGAGTGGACAAGGTCGTGGCCTGNACCTCGGCC
TTCCTACTATGGGACCCGACCAAGGTGCCCCCACCCCTGCAGGACGTGACCGATGACCACATCCGGATGCATAAAATTCT
TGCAAAGAAGTCAGGGCTGAAATACCGTGGGCAGNGATGCCCCCACACATAGGAGACCAACCACTAACTGGGGCCTC
Sequence Type mRNA
Unitrap ID UNI21733

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28244291..28250762 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040466 (Blvrb) NM_144923 biliverdin reductase B (flavin reductase (NADPH)) Gene [Source:MGI (curated);Acc:Blvrb-002]

 
Come back to gene ENSMUSG00000040466


For any suggestions or comments, please send an email to unitrap@crg.es