Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST66760
Clone ID OST66760
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST66760
Sequence
ACATTGCTTTTGTGTGGGGGCTAATGGAGGAGGATCGTGAGTTCTAGGACAGCTGGAGCAACATGCCAAGTCCCTGTCTC
AAAGGAAGGAAAAGAAACCAGTTTCTACGTGTACCCAAGGTTTACAGCATAGCGAGATACACATGGCAGTCATCAGCACA
CGGCAGTCTCTGGACAAGTGAGAAGGGAAGAAAACACCACCGAAGAGTTCCTCAAGAAGAGGTCTAGAAGCAAGAAGCAA
GTGGTTTTGGATCCCTGGATAATTAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI27209

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 24889464..24890202 146
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046219 (C230012O17Rik) RIKEN cDNA C230012O17 gene Gene [Source:MGI Symbol;Acc:MGI:2442283]

 
Come back to gene ENSMUSG00000046219


For any suggestions or comments, please send an email to unitrap@crg.es